×
RECHERCHEZ
Questions2vie.com
Endroit sûr où aborder tes
 questions sur la vie et sur Dieu
Existence de Dieu

Dieu est-il réel ?

La science donne d’amples raisons de croire en Dieu. Pourquoi l’ADN a-t-il cette importance ?

WhatsApp Share Facebook Share Twitter Share Share by Email More PDF

Anthony Flew, philosophe britannique, était l’un des principaux porte-parole de l’athéisme et a participé activement à de nombreux débats. Cependant, les découvertes scientifiques des 30 dernières années l’ont amené à une conclusion qu’il ne pouvait éviter. Dans une interview vidéo en décembre 2004, il a déclaré : « La super intelligence est la seule explication satisfaisante de l’origine de la vie et de la complexité de la nature. »1 Dans sa conclusion, les découvertes dans le domaine de l’ADN ont été déterminantes. Voici pourquoi.

L’ADN dans nos cellules ressemble beaucoup à un programme informatique complexe.

Sur la photo de gauche, vous voyez qu’un programme informatique est constitué d’une série de 1 et de 0 (appelée code binaire). L’ordre et le séquencement de ces 1 et de ces 0 est ce qui fait que le programme informatique fonctionne correctement ou non.

Programmation
informatique :
Photo of binary code computer programming in defined order, just like God has ordered the design of the human body and universe.
Code
ADN :
Photo of DNA chemicals CGTA in ordered rows, much like computer binary code, to show that God designed DNA in the human body.

De la même manière, l’ADN est composé de quatre substances chimiques, abrégées en lettres A, T, G et C. A l’instar des 1 et des 0, ces lettres sont organisées dans la cellule humaine par exemple comme suit : CGTGTGACTCGCTTCCTGAT… L’ordre dans lequel elles sont organisées conditionnant la bonne marche de la cellule.

Ce qui est étonnant, c’est que dans le minuscule espace de chaque cellule de votre corps, ce code compte trois milliards de lettres.2

Pour saisir la quantité d’informations ADN présente dans une cellule, « une lecture en temps réel de ce code à une vitesse de trois lettres par seconde prendrait trente et un an, même si la lecture se poursuivait jour et nuit ».3 Attendez, il y a plus.

Il a été établi que 99,9 % de votre ADN est commun à tous les hommes.4 Ce qui vous caractérise vraiment, c’est la différence minime générée par la séquence de ces trois milliards de lettres dans vos cellules.

L’Etat français se contente d’identifier toute la population du pays grâce à un numéro de sécurité sociale à 15 chiffres. Pourtant, chacune de vos cellules contient une structure d’ADN de trois milliards de lettres qui n’appartient qu’à vous. Ce code vous identifie bien mieux et conditionne en permanence le comportement de vos cellules.

Pourquoi l’ADN a-t-il cette importance ?

Le Dr Francis Collins, directeur du projet du génome humain (qui a cartographié la structure de l’ADN humain) a déclaré qu’il était « possible de considérer l’ADN comme un manuel d’utilisation, un logiciel, installé dans le noyau de la cellule ».5

Perry Marshall, un spécialiste de l’information, en commente les implications. « Il n’a jamais existé de programme informatique qui n’ait pas été conçu (que ce soit un code, un programme ou un message transmis dans une langue). Il y a toujours un esprit intelligent à l’œuvre. »6

Comme l’ancien athée Antony Flew se l’est demandé, il est légitime de s’interroger sur ce code de trois milliards de lettres conditionnant la cellule… qui a écrit le script ? Qui a placé dans la cellule ce code en état de marche ?

C’est comme marcher sur la plage et voir, écrit dans le sable « Mike aime Michelle ». Vous savez que les vagues qui déferlent sur la plage n’ont pas composé ce message ; c’est quelqu’un qui l’a écrit. C’est un message précis. C’est une communication claire. De la même manière, la structure de l’ADN est un script complexe de trois milliards de lettres, instruisant et dirigeant les processus de la cellule.

Comment peut-on expliquer cette messagerie sophistiquée, ce code, résidant dans nos cellules ?

Le 26 juin 2000, le Président Clinton a félicité les personnes qui ont achevé le séquençage du génome humain. Il a déclaré : « Aujourd’hui, nous apprenons la langue dans laquelle Dieu a créé la vie. Nous sommes de plus en plus impressionnés par la complexité, la beauté et les merveilles du don le plus divin et le plus sacré de Dieu. »7 Le Dr Francis Collins, directeur du projet du génome humain, a suivi le Président Clinton à la tribune, déclarant : « C’est pour moi une source de profonde humilité et d’émerveillement que de constater que nous avons eu le premier aperçu de notre propre manuel d’utilisation que seul Dieu connaissait jusque là. »8

Lorsque nous examinons la structure de l’ADN dans le corps humain, nous ne pouvons pas échapper à l’évidence d’un dessein intelligent (incroyablement intelligent).

Selon la Bible (qui est elle-même incroyablement complexe), Dieu n’est pas seulement l’auteur de notre existence, il est aussi à l’origine de la relation qui donne un sens à notre existence. Tous les éléments intangibles de la vie dont nous avons besoin… assez de force pour toute situation, joie, sagesse et savoir que nous sommes aimés… Dieu seul nous les donne lorsque nous l’écoutons et lui faisons confiance. Il est notre meilleur et notre plus fiable guide dans la vie. Tout comme il a conçu l’ADN pour piloter la cellule, il propose de nous expliquer comment bien mener notre vie, pour sa gloire et pour notre bien, parce qu’il nous aime.

Pourquoi l’ADN est-il important ? C’est une preuve de plus de l’existence de Dieu. Il a conçu nos corps. Vous pouvez également lui faire confiance pour mener votre vie. Avez-vous déjà entamé une relation avec Dieu ? Ceci explique comment vous le pouvez : Connaître Dieu personnellement.

Pour plus de preuves répondant à la question « Dieu est-il réel ? », consulter Dieu existe-t-il ?

 J'ai une question…
 Comment commencer une relation personnelle avec Dieu ?

(1) Healthy-elements.com/atheists.html (2) Francis S. Collins, directeur du projet du génome humain, Le langage de Dieu (Free Press, New York, NY), 2006, p 1. (3) Ibid (4) Ibid, p 125. (5) Ibid, p 102. (6) Perry Marshall, ingénieur en information, cosmicfingerprints.com. (D’autres concepts dans cet article peuvent également être attribués à Perry Marshall.) (7) Francis S. Collins, Le langage de Dieu, p 2. (8) Ibid, p 3.


PARTAGER CETTE PAGE:
WhatsApp Share Facebook Share Twitter Share Share by Email More